Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11295C1
Clone ID IST11295C1
Vector VICTR76
Project tigm

Sequence tag IST11295C1HMF1
Sequence
CTGAAAGTCTTCCAAGACTTCCTTGCACCCAGGCGAGTGTTGCTTTANTGTCGATTGGTCGGAGATTCTTTTACAAAGCA
CGTTAACTACAGTGGGCAAGGTTACCTTCATGGCTGCTTGTGGCTGTTGCTTGCTCGGGTTGCTGTGATCACCTTGCCTG
TTGGATTCTTATTTACNTAATTTTTTTTCCCTCANCAAAAGAAAATACAGAGAGTGCTCTCATCTCCCTGANAAAGANAN
TTGATGTCNNCG
Sequence Type genomic DNA
Unitrap ID UNI30916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18138182..18138429 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039835 (Nhsl1) NM_173390 NHS-like 1 Gene [Source:MGI Symbol;Acc:MGI:106390]

 
Come back to gene ENSMUSG00000039835


For any suggestions or comments, please send an email to unitrap@crg.es