Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10008F8
Clone ID IST10008F8
Vector VICTR75
Project tigm

Sequence tag IST10008F8BBF2
Sequence
CACCATCTACAGCACACAACTAGATCATCTGTGCTGGAACAGGGGAAACTGTGTCTTAAGACTCCGCCCCACAGAAGCTA
GTTGGGCCCACGTGGGCCAACGATCGGCTGGGAGGATGAGAAAAATGACTTTACAATAATGTTTTCTTTTTGGCCAAAGA
ATTGTTTTGGGCACAACCAATTTTTAATTACCAATTAATAACAATTATAAAAGCTTTATTTTTTGTAGAAACTTTTGTAG
TAAACTAAAACCCTAAGTAATAAAAGGATATTGTCTCTGAATCTTTTGGGTGAGAGCAAGGATTTAAGGTAAACTTCAAG
AAGCATTAGTTAATAAAATACTTTTCACTTAGGAAACAATATACACTGAAAGATTAAAAATCTTGGCTTCTTGTATAGAA
GCAGAAACAATAACAATTTTTTCTTACATAATGTAAAGTTACATTAGCCATACCTAGAGGCAAAATTTTCTAGTGATTAC
AGTTCACTAGAAGCAAAACTCTTTGAATTTAAGCATTATTTTTAAACATCTGAATAGATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 9873611..10407966 520
 
EST/CDNA Est Name
  BY563808.1


Sequence tag IST10008F8HMF3
Sequence
CACCATCTACAGCACACAACTAGATCATCTGTGCTGGAACAGGGGAAACTGTGTCTTAAGACTCCGCCCCACAGAAGCTA
GTTGGGCCCACGTGGGCCAACGATCGGCTGGGAGGATGAGAAAAATGACTTTACAATAATGTTTTCTTTTTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI15588 UNI15589 UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 84779930..84780085 156
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29592669..29592824 156
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41654448..41654603 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115776704..115776859 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136939799..136939954 156
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52920267..52920422 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10809907..10810062 156
NO GENE  

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es