Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11115H11
Clone ID IST11115H11
Vector VICTR76
Project tigm

Sequence tag IST11115H11HMF1
Sequence
GTTCAAGGCCAGCCTGGTCTACACAGTGAGTTCCAGGTCAGCCAG
Sequence Type genomic DNA
Unitrap ID UNI2526 UNI6206 UNI32771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 35046555..35046599 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 37431869..37431913 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20074976..20075020 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 19041805..19041849 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18677797..18677841 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 33018529..33018573 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 47344079..47344123 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3939785..3939829 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014232 (Cluap1) NM_029738 clusterin associated protein 1 Gene [Source:MGI (curated);Acc:Cluap1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10584920..10584964 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 42061610..42061654 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4375958..4376002 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29210366..29210410 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026799 (Med27) NM_026896 mediator complex subunit 27 Gene [Source:MGI (curated);Acc:Med27-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 17438351..17438395 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 36479420..36479464 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9204698..9204742 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 86247980..86248024 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26002172..26002216 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 35973518..35973562 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031529 (Tnks) NM_175091 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase Gene [Source:MGI Symbol;Acc:MGI:1341087]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 18211126..18211170 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39285365..39285409 43
NO GENE  

 
Come back to gene ENSMUSG00000031529


For any suggestions or comments, please send an email to unitrap@crg.es