Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14026C9
Clone ID IST14026C9
Vector VICTR74
Project tigm

Sequence tag IST14026C9HMF1
Sequence
CTGTGTAAACTTGGCTGTCCTGGAACTCACTGTGTAGACCAGGCTGGCCTT
Sequence Type genomic DNA
Unitrap ID UNI31645 UNI34817

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 152667053..152667103 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066842 (Hmcn1) NP_001019891 hemicentin 1 Gene [Source:MGI (curated);Acc:Hmcn1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 104740972..104741022 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114517046..114517096 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24486062..24486112 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035435 (Abca17) NM_001031621 ATP-binding cassette, sub-family A (ABC1), member 17 Gene [Source:MGI (curated);Acc:Abca17-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 10117509..10117559 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 22910913..22910963 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40570971..40571021 47
NO GENE  


Sequence tag IST14026C9BBF1
Sequence
TTGTGTAAACTTGGCTGTCCTGGAACTCACTGTGTAGACCAGGCTGGCCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166364: 5386..58349 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166389: 45474..138588 38
NO GENE  

 
Come back to gene ENSMUSG00000035435


For any suggestions or comments, please send an email to unitrap@crg.es