Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST12529-NL
Clone ID PST12529-NL
Vector U3NeoSV1
Project escells

Sequence tag PST12529-NL
Sequence
CATGCCAGAGAGGACATGGGAGGTTCTTTGTCAGTTTCCACCCATCATTTGAAGCAATGTCTGGAACCTGTCTAGGCTGG
TCAAGGTCCCAGTCATATTCCTGTCTCCATCCTCTGGGAGTCTGGTAGTTAAAATTGTGTACTGACTCAGGGGTTGGTTG
TTATGTGCACGTCTGGGATATAACTCCGGTCTTGAGGGTTGTGTC
Sequence Type genomic DNA
Unitrap ID UNI9962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 144645879..144646077 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031068 (Glrx3) NM_023140 glutaredoxin 3 Gene [Source:MGI Symbol;Acc:MGI:1353653]

 
Come back to gene ENSMUSG00000031068


For any suggestions or comments, please send an email to unitrap@crg.es