Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14704F3
Clone ID IST14704F3
Vector VICTR76
Project tigm

Sequence tag IST14704F3BBF1
Sequence
TTAAGTATAATTTGGTTATATCAATCTGGAATGGTCTGGAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117085025..117085068 44
NO GENE  


Sequence tag IST14704F3HMR1
Sequence
NTATAAGCTATAAAACGCAGCCTTAAGACCTGCTTGCACAGGGAGAGAACAGTTACCATTAAGCAGAAATTTGGTGGCAA
ACACCATCCTCACTAACTTGACTGTCTTCCTCATCCTGCCCCCTGAATTGTATGTGGGAGGCTTTGAGCCCTCATAGCTT
TTANNCANCCACTGGGATTTGAACCCGGATCTGAATGGATTGGCACACACATTTGTCCTTTTAACTACACGTTCCAGGGA
GAGTTCCACTANGCCCTGGATCCCTCCCAGACAACTGTCTANATTTCTCCTTCGTGAGACTGGTCAGCCATCATCTGACT
CATCCCTGCCAGGCTATCTGCCCATCTTCCANCTCCNTGGANGATCCCCTGAAAAGGAACCAAGTGGGGCCACAAGGTTG
CTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117084622..117085026 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST14704F3HMF1
Sequence
ATAAGTATAATTTGGTTATATCAATCTGGAATGGTCTGGAGGATCCCTCAAGGTAAAAGGGAAGAAAAGAAGGGACAGAG
GGACAACGTATGCAGAAAGGATAAATGCCACCTTCTTGAGATAGAAAAGGTCACGTGGCTTTGGCAAATGTATTTTTCCT
AAGAAGAAACTCATTCTGTGCTAAGATGATGCAGGTGCCAGGAGACTCTTGGGCCATGGCTGTCAAGTATCAGATGCCAT
TTGAAAAATCAAATCTGGAANAGGGGGTGCCCCCGCCCCCTGTAACAAGCTTGGAGGACTTGCAGGGGGACCAGCCATTG
TAAATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117085024..117085350 325
NO GENE  

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es