Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15007C7
Clone ID IST15007C7
Vector VICTR78
Project tigm

Sequence tag IST15007C7BBF1
Sequence
CTGGATTCAGGATCTGTTGGAACACCCAAATACAAGGATGCTTAATTCTCTTATAAACATAGTATTAGCCTATAATTTAC
ATGCATCTGCCGGTGTATTTTAACTAATCTTTACTTATCCTACCTAATACATTTAAATCCTANATACACAATTGCTATAC
TATATTGCTTAAGAAATAATGACCAANACATTACGTTTGTNCNCNTACAGTACATGTCACTACNNCNNACNTNACCACAT
NNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15007C7HMR1
Sequence
AGTACCCCGTGGATGTGGAGGGGCGTTTCTGTTTGACTGGCTTGTGTTTTGTTGTTGTTGTTGTTGATGATGATGATGTC
TTANTCACTTGTTCCTCTGAAGAGACACCCAGAGTGACAATGAAATGCCATTTTTGTGGAACACAGTACACACATGGTAC
ATGAAACATACATGCAGATAATACCTGTGCACATTANANANATGAATANTGGATCCCTTTANCANAGTTAAAAGAGACGT
CAGGTGTAAAAAGTAAGATGATGATGTATGCCTCTCCCGTGGAGCCTANCCTGGCTTCAAATTGTCCTCCTGCCTCANCC
TCNCNANTGATGGTATGGTANGTGTGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI10762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49778727..49779076 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]

 
Come back to gene ENSMUSG00000037851


For any suggestions or comments, please send an email to unitrap@crg.es