Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST14223-NR
Clone ID PST14223-NR
Vector U3NeoSV1
Project escells

Sequence tag PST14223-NR
Sequence
GTTCTAGCCACCCCTGCGCCATTGGGTACTACCGTAGTTCCTGGTGTAGTTCACCCTGTGCTTTATCACAAGCTGTGCTC
TGCCCTCTCTCCTTTACCCTCTCCTGTAACTACAGTGACACATACAGGAGTGTGCTGTGCACACACCTTTCTTCTCAGTC
AGTCTTGTTCCACATTATATGCGGAGCACTTATGTGCTGTATACTCAATTTTTAGTAAATGTATTTACAGACTGAGAGGA
AATGAAGAAGTTTGGCTGCGTGCTGTCCTT
Sequence Type genomic DNA
Unitrap ID UNI15042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119602921..119603186 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034032 (Rpap1) NM_177294 RNA polymerase II associated protein 1 Gene [Source:MGI (curated);Acc:Rpap1-006]

 
Come back to gene ENSMUSG00000034032


For any suggestions or comments, please send an email to unitrap@crg.es