Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14600B3
Clone ID IST14600B3
Vector VICTR74
Project tigm

Sequence tag IST14600B3HMF1
Sequence
CTCGTTGCACACAGCGCTTGGAACAGGTTATCCCTCCATGCCGAGCTCCCGCCTTCTCACCCAGCCAAAAATTAATATTC
ATTTCTCCTTAAGCCCCANACTTCCCCTTCCANAGCCCTTTACAAGCGTTCCAAGCTATGAGCCATGACCTGCCTGTCAT
GCACAATCCTGAAACTCCATTCCAGTCACTAATTCCTAAAGTCTCCACTGTCACTCACAGACTTCCCAGCCACCTACGTC
AGTCTCCATTCCCAGGAGCGCTCCTAGGTCTCCGCTTAGGCTCCGCCCTCTCACGTAATCGTAGCCTACTGAAGCTCTTA
CCAGGCCCGCCGGAAGCCCCGCCCCGGGAGGTTGCTAGGCTCCGGCAGCCGGAAGTCCCGCCTGTGGAGTAGTCGTCNCT
GCCGCCGCCGCCTCCGTTGTTGTTGTGGTCGCTTCGCCGAANTCCGCGGCTCGAANANCCGGCTCCGTCNCTTCCCGTCG
CCATGAAGTNGNNGTTTAAGAGGACCACTCTNNGGGTAN
Sequence Type genomic DNA
Unitrap ID UNI34823

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114464237..114464755 491
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]

 
Come back to gene ENSMUSG00000031950


For any suggestions or comments, please send an email to unitrap@crg.es