Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST14209-NL
Clone ID PST14209-NL
Vector U3NeoSV1
Project escells

Sequence tag PST14209-NL
Sequence
CCATCTCACTCATTCCAGGCATTTCCGGTTTTGGGGATTCCAACTCAGAACTTTTTTTTTTCAAACGACCCCCCTCTCCC
TTAAAATGGAGTTGGGCGGGGGGGGAATGAAAAACTGAGTTGGTCTTTACTTTTTTTAAAAAGAGACTTTTTTGATCCAA
TGAGGCCCCACAAGTAACTGAGTTTGGGTCCTGGTTGGTTGCTTTATTTTTTTTCCTCCAAAATTTTACCCCTCCCCCCT
GAGTCCCGAGGTGCTGACGTCGCAAAAAAATTGGATAGTAAGTGTCGAATTTTCAAAAACCAGCCTT
Sequence Type genomic DNA
Unitrap ID UNI15043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36054445..36054691 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es