Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13758F4
Clone ID IST13758F4
Vector VICTR74
Project tigm

Sequence tag IST13758F4HMF2
Sequence
TTTTTTGTTTTTGTTTTTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGNTGA
Sequence Type genomic DNA
Unitrap ID UNI7410 UNI14427 UNI34826 UNI34827 UNI34828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7126449..7126499 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88487166..88487216 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 57896679..57896729 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022361 (Zhx1) NM_009572 zinc fingers and homeoboxes 1 Gene [Source:MGI Symbol;Acc:MGI:109271]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99386826..99386876 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 43375819..43375869 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79981500..79981550 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108544258..108544308 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56584398..56584448 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109479470..109479520 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041308 (Sntb2) NM_009229 syntrophin, basic 2 Gene [Source:MGI Symbol;Acc:MGI:101771]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11888993..11889043 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6954837..6954887 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070837 (Aurkc) NM_001080965 aurora kinase C Gene [Source:MGI Symbol;Acc:MGI:1321119]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20941052..20941102 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047221 (AI847670) NM_177869 Uncharacterized protein MGC35361 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7TPD2]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 39216772..39216822 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12497581..12497631 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 133898230..133898280 49
NO GENE  


Sequence tag IST13758F4BBF1
Sequence
TTTTTTGTTTTTGTTTTTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGCACTCACTTTGTAAACCAGGCTG
GCTTTGAACTCANAAATCTGCCTGCCTCTGCCTCCAGAGTGCTGGGATTAAAGGCGTGCGCCACCANNCCNANCTNANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000047221


For any suggestions or comments, please send an email to unitrap@crg.es