Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11570E5
Clone ID IST11570E5
Vector VICTR76
Project tigm

Sequence tag IST11570E5HMR1
Sequence
NNACCTGGGTATAGGGGCGAAAGACTAATCGAACCNTCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATANCTGGC
GCTCTCGCTCTTTTTTTCCCCGACGTACGCAGTTTTATCCGGTAAAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATC
TCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCNAGTGCCTANT
GGGCCNNTTTTGGTAANCANAACTGGCNCTGCNGNANNANNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15519842..15520110 248
 
EST/CDNA Est Name
  BY338333.1 - BI899395.1 - CF585877.1 - CN693212.1 - CV675776.1 - AA989936.1 - DV075533.1 - AI876143.1 - AA266239.1 - AA060712.1 - AA239708.1


Sequence tag IST11570E5BBF1
Sequence
NGACGACCGATTTGCACGTCAGGACCGCTACGGACCTCCACCANAGTTTCCTCTGGCTTCNCCCTGCCCAGGCATAGTTC
ACCATCTTTCGGGTCCTAACGCGTACGCTCGTGCTCCACCTCCNNGGCGCGGCGGGCGAGACGGGCCGGTGGTGCGCCCT
CGGCGGACTGGAGAGGCCTCGGGN
Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391506..57391687 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]

 
Come back to gene ENSMUSG00000075007


For any suggestions or comments, please send an email to unitrap@crg.es