Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11943D7
Clone ID IST11943D7
Vector VICTR76
Project tigm

Sequence tag IST11943D7HMF1
Sequence
AGANAGCATTTTNATGCAAAAGCACGGGAAAAGTGAGCACTGCAAGGTGCTCCCTACAGAGGATCANAACCCAACAATAG
ACAGCTGTCTTTGTTTGCAGAGAACTTAGCTTCTGGGTGTTTGGTGCTGCTTCTTAAATGCTGCTCTAGTCCAAGGGGGT
GGTTAACGCC
Sequence Type genomic DNA
Unitrap ID UNI34832

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 75868407..75868574 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075270 (Pde11a) NM_001081033 phosphodiesterase 11A Gene [Source:MGI (curated);Acc:Pde11a-001]

 
Come back to gene ENSMUSG00000075270


For any suggestions or comments, please send an email to unitrap@crg.es