Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12262F4
Clone ID IST12262F4
Vector VICTR76
Project tigm

Sequence tag IST12262F4BBF1
Sequence
AAGGGTGTTTCAAGGGAAGGGGCACTTGGGCCCCCACCTTAGACCTACTAAATCAAAGTCTGCTTGGGGGCTGGAGAGAA
GGTTCAAAGACTTAAGAGCACTGGTTGCTCTTCCAGAGGACCCAGGTTCAATTCTCAGCACCCACATGGCAGCTCACACC
TGCCTAACTGCAGTTCAAGGTGATCCAATACCCTCACACAGACATACACTCAGGCAAAACACCAGTGTACATAAATACAT
TTTTTTTAAAAGGGCTTCAGTTCACTCTTCGCTCAGGTCTGCCTGGAACATATTATACAGGTCAGGTGGCCTTCAAGCAC
ACAGCAAACCTCCTGTCTCCTCCAGAATGCTTGGATTGCAGGTAGAGATTAAACCCAAGGCTTCAAGGCCACCCAGTCTA
CCTACTGAGCCNCATCCTTAGCCCCAATTCTGCCTTTTGCTTCCATCCCTGGGGGGACTCATTTGCATATTANCCTTTTA
GAAGCTTANNGATAGAATTCCCTTTCTGCTGTGAATAGGANCCCTTAATCCCGANNAN
Sequence Type genomic DNA
Unitrap ID UNI16290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48799326..48799858 520
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032267 (Usp28) NM_175482 ubiquitin specific peptidase 28 Gene [Source:MGI Symbol;Acc:MGI:2442293]

 
Come back to gene ENSMUSG00000032267


For any suggestions or comments, please send an email to unitrap@crg.es