Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12042D8
Clone ID IST12042D8
Vector VICTR76
Project tigm

Sequence tag IST12042D8BBF1
Sequence
CTATTGGATGGATCACANGGCCCCCAATGGAGGAGCTAGAGAAAGTATCCAAGGAGTTAAAGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51352441..51352509 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 74983085..74983153 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 62433079..62433147 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 83844333..83844401 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 81329279..81329347 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 63271584..63271652 67
NO GENE  


Sequence tag IST12042D8HMF2
Sequence
ATGGCAAGGAGAGGGGCTCTTCTCCCTCCTCTGGGCCGCCCTCTCCCTCTTATGTCTCCCTCCCCCCACCAAATATTGGC
CCCTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI30653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4777928..4778015 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053550 (D430041B17Rik) NM_172737 RIKEN cDNA D430041B17 gene Gene [Source:MGI Symbol;Acc:MGI:3605641]

 
Come back to gene ENSMUSG00000053550


For any suggestions or comments, please send an email to unitrap@crg.es