Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14119E1
Clone ID IST14119E1
Vector VICTR74
Project tigm

Sequence tag IST14119E1BBF1
Sequence
CTGATGCCCTCTTCTGGTATGTCTGGAGACAGCTACAGTGTACTTACATGTAACAATAAAAAAAATCTTAAAAAAAACTG
CATGGTACTGGTACAGCGACAGACAGGTANATCAATGGAATAAAATTGAAAATACAGAAATGAACCGACACACCTATGGT
CACTTGATATTTGACAAAGAAGCTAAAACAATCTAGTGGATGGTACTGGTTCAACCAGCAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100441555..100441777 217
NO GENE  


Sequence tag IST14119E1HMR1
Sequence
ATGGATGGTTGTGAGCCNCCATGTGGTTGCTGGGATTTGAACTCAGGGCCTTCGGAAGAGCAGTCAGTACTCTTAACTGC
TGAGCCATCTTGCCAGCCCACCATGCAGTTTTTATCACAATTGCTGTGTAGTACAGCTTGAGGTCAATCATGGTGATTCC
CCCANAGGTTCTTTTATTGTTGAGAATAGTTTTCACTATCTTGGGTTTTTGTTATTCCAGATGAATTTGCAAATTGCTCT
TTCTTGCTATATAAACATTGAGTTGGAATTTTGATGGGGATTGCATTGAATCTCTATATTGTTTTCAGCAAGATAGCCAT
TTTTACTATATTAATGCTACCAATACATGAGCATGGGAGATCTTTCCATTTTCTGAGATCTTCTTCNATTTCTTTCTTCN
NAGACTTANNTTNNTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100441120..100441546 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]


Sequence tag IST14119E1HMF1
Sequence
TGATGCCCTCTTCTGGTATGTCTGGAGACAGCTACAGTGTACTTACATGTAACAATAAAAAAAATCTTAAAAAAAACTGC
ATGGTACTGGTACAGCGACAGACAGGTAGATCAATGGAATAGAATTGAAGATACAGAAATGAACCGACNCNCCTATGGTC
ACTTGATATTTGACAAAGAAGCTAAAACAATCTANTGGATGGTACTGGTTCAACCAGCAGTCNACNNGTAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100441556..100441785 218
NO GENE  

 
Come back to gene ENSMUSG00000031325


For any suggestions or comments, please send an email to unitrap@crg.es