Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12663D8
Clone ID IST12663D8
Vector VICTR76
Project tigm

Sequence tag IST12663D8HMF1
Sequence
CACTGACCTTTAAGTTCTCATCCTTATACCTCCAACCTGCCCAAGTGTAGTCAGGAGAGGAGTGTGCACCATGTCTAATT
TATACAGTGTTTGGGCTCAGACCTAAGGCTTTGTGCATGCTAGGCAAACACTCCACCTACTGAGAGCCACATCCTCAGCT
GTTA
Sequence Type genomic DNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106672823..106672985 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]


Sequence tag IST12663D8BBF1
Sequence
CACTGACCTTTAAGTTCTCATCCTTATACCTCCAACCTGCCCAAGTGTAGTCAGGAGAGGAGTGTGCACCATGTCTAATT
TATACAGTGTTTGGGCTCAGACCTAAGGCTTTGTGCATGCTAGGCAAACACTCCACCTACTGAGAGCCACATCCTCAGCT
GTTGACTTTATCTAAGAAACCTGGAAGGTAAAAGCTGGGAGTGGTTATACACATCTATAATCCCCGCAGAGGAAGGTCTT
AGATAAGAGAGAGCCTGCAGAAGTAGTTTAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106672711..106672985 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]

 
Come back to gene ENSMUSG00000040661


For any suggestions or comments, please send an email to unitrap@crg.es