Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14511E10
Clone ID IST14511E10
Vector VICTR74
Project tigm

Sequence tag IST14511E10HMF1
Sequence
ATACAGAGAAACCCTGTCTCAAAAACCAAAATAAAATAAAATAAAATATAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166439: 98185..176086 38
NO GENE  


Sequence tag IST14511E10HMR1
Sequence
GTATAGCCCTGGCTGTCCTGGAACTCACTTTGCANACCAGG
Sequence Type genomic DNA
Unitrap ID UNI14335 UNI30748 UNI31225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35910439..35910479 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8393457..8393497 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13821507..13821547 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 28456400..28456440 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 39527439..39527479 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45300991..45301031 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22794446..22794486 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107357093..107357133 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010066 (Cacna2d2) NP_064659 calcium channel, voltage-dependent, alpha 2/delta subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1929813]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 36516917..36516957 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12856311..12856351 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 12269330..12269370 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 93997794..93997834 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045095 (Magi1) NM_010367 membrane associated guanylate kinase, WW and PDZ domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1203522]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52788648..52788688 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53760471..53760511 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32681405..32681445 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33004317..33004357 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027674 (Pex2) NM_021483 peroxisomal biogenesis factor 5-like Gene [Source:MGI (curated);Acc:Pex2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7564243..7564283 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 57266691..57266731 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 17225012..17225052 39
NO GENE  

 
Come back to gene ENSMUSG00000027674


For any suggestions or comments, please send an email to unitrap@crg.es