Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST14062-NL
Clone ID PST14062-NL
Vector U3NeoSV1
Project escells

Sequence tag PST14062-NL
Sequence
GAAGAGAGCGGAGAGGAGAGCCCAGCTAAGAAGAAAGAGCTTAGTGAGCCCAGATCCAGAAGTAACAGAGCAGAGAGAAC
AGCCAGGGAGAGAAAGAGCTATAAGCAGAAAAGCAGGCCTGGGGAGGCCAACTGGAGGCTTGCGAGACAGCGAGGCAGAG
AAGGAAGGGGGCACAGTGGGCAGTGGGGACAGCAGTGAGGAGGGGGAGGCAGAGAAGGAAGGAGGCACAGTGGGCAGTGG
GGACAGCAGTGAGAAGGGGGAGGCAGAGAAGGAAGAGGGCACAGTGGG
Sequence Type genomic DNA
Unitrap ID UNI15053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134007081..134007367 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042606 (Hirip3) NM_172746 HIRA interacting protein 3 Gene [Source:MGI (curated);Acc:Hirip3-001]

 
Come back to gene ENSMUSG00000042606


For any suggestions or comments, please send an email to unitrap@crg.es