Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14281A3
Clone ID IST14281A3
Vector VICTR74
Project tigm

Sequence tag IST14281A3HMF1
Sequence
NTCTCAGACTCTGACCCCCCCTACACATACACACTCACACCACANAAAGGACAGGAAGGTAGGAGGAGGTGTGCTGGGGA
CATTAGGAGACTGGGGAAGGGATAGTTAAGGACAGGATATACACTTGACTGTACCTACTCTGTANAACACAGAATCATGG
ATGCTGCCATCTTTGAACAGTTTCTCCCANNNTGAATCATTGTGAACAGAAAAGCTGGGCAGCTTGGGGAAAAGCTGTAA
CCATCAAATGAAGCAAGACAAGATCACTGTAATGCCNAGGTACCTTTTTCTAAAAGGTATTTGCAATCTCTCCAAAAAAG
TACTTGAAGAATANGGGCTCANGGTGTGGCTCAATTGGTANAGTGCTTGCCTAGCATGCANGAANCCCTGANTGTGAGTC
NCAGCACTACAGAAACCTGTGCGTGGTGGANCATCCCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163491219..163491656 410
NO GENE  


Sequence tag IST14281A3HMR1
Sequence
AGACGAGTGGTGCTGCCTGGTGCAGATTGGTGGGGATGTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163491654..163491696 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035268 (Pkig) NM_001039390 protein kinase inhibitor, gamma Gene [Source:MGI (curated);Acc:Pkig-001]


Sequence tag IST14281A3BBF1
Sequence
GTCTCAGACTCTGACCCCCCCTACACATACACACTCACACCACAGAAAGGACAGGAAGGTAGGAGGAGGTGTGCTGGGGA
CATTAGGAGACTGGGGAAGGGATAGTTAAGGACAGGATATACACTTGACTGTACCTACTCTGTAGAACACAGAATCATGG
ATGCTGCCATCTTTGAACAGTTTCTCCCAGAGTGAATCATTGTGAACAGAAAAGCTGGGCAGCTTGGGGAAAAGCTGTAA
CCATCAAATGAANCAAGACAAGATCACTGTAATGCCAAGGTACCTTTTTCTAANAGGTATTTGCAATCTCTCCAAAANNG
TACTTGAAGAATANGGGCTCANGGTGTGGCNNNNTTGNTANAGTGCTTGNCNANCATGCNGGANNCCCNGANTGNNANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035268


For any suggestions or comments, please send an email to unitrap@crg.es