Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14906B6
Clone ID IST14906B6
Vector VICTR76
Project tigm

Sequence tag IST14906B6BBF1
Sequence
TATCGTTTTATAAAACACAAGAATTAAGTATCTCATAGGTGTTGCAAAGCAGCAATAAAGCTTTTAAGTGCAGATCAGAA
AAAAGTACCTTGTCAAGATGGACAGCAATCCACATGACTAAAGCAAGCCTGTAATTACTGTGTGGCACTTTGTTTTCCTT
TGCACGGTGGGAACTTTATGTATATGTATATGTATATAAATTCTTTCCATCAAACCCATCTCTCCTCTCCAATTCCTCTC
CAAGCCTCCTGCTACTTTGTACATTTTTATTCTCACAATCACATAACTAAATTTGAAGCCCTTTAACACTTCTACTAAAC
TTTTGACTGGTCGATCTACTAGACCCTACCTGAGGTATGCGGAAAGTTTTTCTGGAGACAATGGAATGCCTTAGGGGGTN
AAGGTGCTGANGTGAAAGAAGTCTGGTGAGCTCANCCCCTCANACACCCAANGTGAAAGAAAGGTGAGATCNGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5859696..5860166 461


Sequence tag IST14906B6HMF2
Sequence
TTGGTATACAGAGAATTCATCCCTAGAAAGTAACGTATAATGTCACATCTCCACCCCTGCANCACACAATGTCCTCACAC
TCAAAGGAACCCCGGTGGAATAGTATGTGGTAGATTGTGACATTCTGTGAGGCTCCTCCCCCAACCAATATCCTGGAAGA
GGAGGGAAACGCTCGATTCAGCTATGAGAGGAATGCTTGCGCCTTGGGCATCCACAGTAGCTGGATTGTGGGACTGTGTG
CCCTGCCTAGGCCCGGGGCTGACTTCTTAGCTGGCCTTCAAAGGACAGATCGCCATTGAACTCTGGGCAATACCCAAAAG
TAGCTCGAGGAAGCCGAGAGCTGTGTTTCTGCAGTGCGCACCATCGATCCNTAGCATTTGAAGCTATTTTTCTCTGCAAG
CGTCCNCAAAATTCATTACTTTACAATGAGCCTGGCAGGGACTGCGGCAGCAGGGAAACTCTACACGGGTCCCANGCGCT
CTCTCTCTCTCTCN
Sequence Type genomic DNA
Unitrap ID UNI11370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101212854..101213344 483
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042035 (Igsf3) NM_207205 immunoglobulin superfamily, member 3 Gene [Source:MGI Symbol;Acc:MGI:1926158]

 
Come back to gene ENSMUSG00000042035


For any suggestions or comments, please send an email to unitrap@crg.es