Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15006E9
Clone ID IST15006E9
Vector VICTR78
Project tigm

Sequence tag IST15006E9BBF1
Sequence
ATAGGACCCTGTCTTTGAAAAAAATAGAGACAAAGAGCCCAGCCTGCAAGTGCAGCTACCCTGGACACTTGGTCAAGGAG
GATCACTGTACTTAAAGGCTGGGCTACATTATGAGTTCNNTNNCCTGGTAACAGTAANATAAGACCGATCCTAANTTGCT
TGCTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 73904328..73904493 154
NO GENE  


Sequence tag IST15006E9HMR1
Sequence
AAATGACATAAAAATCNAGAGGGTGTTTGTGACTCCATAATCCCGCGGGAGTATTTTCTATTCCCAAACGCTGCCTTTCC
CAGCTTCTGCTCCAGCGCCAGGCACAGCAGGCTGGTGCACTAGGAGATCTAGGAGGCAGGTGATCAGCCTTATTTAGATG
TGCCAGGGATCACGTGACCAGAAAATGGAGGCGAATCTGTACTTGGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI34554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17211085..17211294 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039126 (A230083H22Rik) BNIP2 motif-containing molecule at the C-terminal region 1 [Source:UniProtKB/Swiss-Prot;Acc:Q52KR3]


Sequence tag IST15006E9HMF1
Sequence
NTANGACCCTGTCTTTGAAAAAAATANAGACAAANAGCCCANCCTGCAAGTGCNNCNNCCCTGGNNACNTGGTCAAGGAN
GATCACTGTACTTAAAGGCTGGGCTACATTATGAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039126


For any suggestions or comments, please send an email to unitrap@crg.es