Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14325A4
Clone ID IST14325A4
Vector VICTR74
Project tigm

Sequence tag IST14325A4HMF1
Sequence
TCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTTTTTAAAGACAAGGTCTCACTGTGTAGTCCTGGCTATCCTGAAACTTGG
AGCTCCACCTACCTCTGCCTCCCGCATACTTGGATTGTGGTCATGCACCATCAACACCCAGCTCTTCTTTTTTCCAACTC
TTTTTTTTGGGGNNNNNNGGGTGGGGAGGGGNTNCNANNCNNNGTTNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48800580..48800770 179
NO GENE  


Sequence tag IST14325A4HMR1
Sequence
GAGAAGAGAAGAGAAGAGAAGANAAGAGAAGAGAAGAAGCTAATATAGAGACCTTGAAACCNCAGCCCTGACCAGGATCA
CCTCAGCTGAGGGGATGAGGCAAGTGGGTTTCTAGATCTCTGCAGGGATGGAGGTGTTAAGTGAAGTTTCNGCNNAGCTC
TCATCGTANGGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI16290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48800769..48800944 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032267 (Usp28) NM_175482 ubiquitin specific peptidase 28 Gene [Source:MGI Symbol;Acc:MGI:2442293]

 
Come back to gene ENSMUSG00000032267


For any suggestions or comments, please send an email to unitrap@crg.es