Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST14003-NR
Clone ID PST14003-NR
Vector U3NeoSV1
Project escells

Sequence tag PST14003-NR
Sequence
CGTATGACTACCAAGTTTTACCTGTCTGAGTCCCTCCATAACTTGACCAGCATCCAGAAGGAAGTAGCCCTGCCTCCCTG
CTCCTGTTGAGGAAACCTGGCCATGGTATCTCTCCAATACTCGAAATTTTAAAGAAGTGTCCGAATAACTCTCTCAGTCG
ACCACTCTAGTCTAACAGTCTGACTATGCAGTGGATAAATAACAACATTGTATCATGTATTTCCTTTACCAACCCAACCT
Sequence Type genomic DNA
Unitrap ID UNI15057

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55194172..55194312 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022178 (Jub) NM_010590 ajuba Gene [Source:MGI Symbol;Acc:MGI:1341886]

 
Come back to gene ENSMUSG00000022178


For any suggestions or comments, please send an email to unitrap@crg.es