Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14546D9
Clone ID IST14546D9
Vector VICTR74
Project tigm

Sequence tag IST14546D9HMR1
Sequence
TTTTATCTAAGACCCGAGTAACATTTTCTCGTGCATGTGTGTGTTTTTGTTTATATATATCATACAGTTTATTAATTTGT
CCAGCAACAAATACTTACAATTATTTTCGTCTTGACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62241967..62242086 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


Sequence tag IST14546D9HMF1
Sequence
AAAAGATGAGATTTTCCTTTAATTAAAATACTCATGTGCCTAGAAGACATTAGATTTATTGAAATAAACCAGACATAGAA
AGATAATGTTTTATGATCTCACTTATATATGTTTGGCATATAAAAAAAACATTCAAATATGGTAAAGCAGACATAACCAG
AAATTACAAAACACTAGATATAATGGGTAGGTAAGCCCAAATATCTAATGCATAAAACTAGGAATGAATGTAATAAAACT
ATACTGTATTTGGGATTATTTTTTTCAATAAATATTTTTTAAAATATTTATTTTGGGCCAGGTACGGTGGCACATATCTT
TTGACCCAACTCTCAGAAGGTAGAGGCAGGCGGATCTCTTTGAGTTCAAGGTCAGTCTGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62242083..62242464 382
 
EST/CDNA Est Name
  CB237259.1 - BE376542.1 - CK333484.1 - BQ569134.1 - AL363894.1 - CA532191.1 - CN678576.1 - BQ942460.1 - BG293025.1 - BG146304.1

 
Come back to gene CB237259.1 - BE376542.1 - CK333484.1 - BQ569134.1 - AL363894.1 - CA532191.1 - CN678576.1 - BQ942460.1 - BG293025.1 - BG146304.1


For any suggestions or comments, please send an email to unitrap@crg.es