Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13390G2
Clone ID IST13390G2
Vector VICTR74
Project tigm

Sequence tag IST13390G2BBF1
Sequence
TATGCATTTAGATAAAGCTGTATATACCCATTTATAATGTTTGTGTTCCTCAACTTGCTTCAAGGTGATCAACTCATAGC
CCATCCTGCTCATTCCAGATATTCGTAACCTCATGGGTGGGGTCATTGTCATGCATGTGCAGATCNNAAAAGGTCTTGCC
CAATTTGACTGGTNNCNNTNCNNNGANTCNCTTTTANATTCAAATTGTTTANNNCTTACANANTCNNCAAAANANACAAT
GGCCTGTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13390G2HMF1
Sequence
TATGCATTTAGATAAAGCTGTATATACCCATTTATAATGTTTGTGTTCCTCAACTTGCTTCAAGGTGATCAACTCATAGC
CCATCCTGCTCATTCCAGATATTCGTAACCTCATGGGTGGGGTCATTGTCATGCATGTGCAGATCANAAAAGGTCTTGCC
CAATTTGACTGGTAACAGTACAATGAGTCACTTTTAAATTCAAATTGTTTATCACTTACATAGTCATCAAAAGAAACAAT
GGCCTGTGTCCCTAACTTCCGTAGCCCTGTACCCCATTGGAAAAAAAGATAATGCTGAAACAAAATGGACCNAATGACTT
GACTCCCATCACAGANAAACCCATTGAAGATTGAAAGTTTTGCAGCTCCNAACTGAGNCAAAACANAAGGCCTAGTACCC
AAAANAAGGGAGGANGTGATTANAAAGCATCTTGTGACAGCANANGGTTTAAAGAGAGATAANGANCCCANANGGN
Sequence Type genomic DNA
Unitrap ID UNI15375

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90909251..90909725 443
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es