Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11848C3
Clone ID IST11848C3
Vector VICTR76
Project tigm

Sequence tag IST11848C3HMF1
Sequence
CCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAATAAATAAATCTTTAAAAAATTCATAATAAAT
GAAAAATATAACCAGTCTTCTTGGAACTCCTTTCCAGTAACTCAGACTGAAGACTAAGCTAGCTGCAAAGTTACAGTGAT
CCACCTCCCTCTGCCACCACCACCACCACCACTGCCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11848C3BBF1
Sequence
CCTCTTCTGGTGTGTCTGAAGACAGCTACNGTGTACTTACATATAATAANAN
Sequence Type genomic DNA
Unitrap ID UNI18332 UNI32318 UNI32711 UNI34727 UNI34843 UNI34844

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166402: 2073..2121 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 309522..309570 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056050 (Mia3) NP_796363 melanoma inhibitory activity 3 Gene [Source:MGI Symbol;Acc:MGI:2443183]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 144686..144734 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3958254..3958302 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 5350887..5350935 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3300607..3300655 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4538473..4538521 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5073805..5073853 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12405576..12405624 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3821158..3821206 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020661 (Dnmt3a) NM_153743 DNA methyltransferase 3A Gene [Source:MGI Symbol;Acc:MGI:1261827]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4577894..4577942 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020412 (Ascc2) NM_029291 activating signal cointegrator 1 complex subunit 2 Gene [Source:MGI (curated);Acc:Ascc2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 5858048..5858096 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12362561..12362609 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6878725..6878773 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11577105..11577153 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5791247..5791295 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029757 (Dync1i1) NM_010063 dynein cytoplasmic 1 intermediate chain 1 Gene [Source:MGI (curated);Acc:Dync1i1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3244893..3244941 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5050186..5050234 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4557848..4557896 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 19975653..19975701 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002428 (Hltf) NM_009210 helicase-like transcription factor Gene [Source:MGI Symbol;Acc:MGI:1196437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7584809..7584857 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4815608..4815656 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026662 (Sephs1) NM_175400 selenophosphate synthetase 1 Gene [Source:MGI (curated);Acc:Sephs1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9780986..9781034 47
NO GENE  

 
Come back to gene ENSMUSG00000026662


For any suggestions or comments, please send an email to unitrap@crg.es