Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST13913-NL
Clone ID PST13913-NL
Vector U3NeoSV1
Project escells

Sequence tag PST13913-NL
Sequence
CTTGGAAAGGGAGGCAGCCGGAAGGAGGCCCCACTTCCCTTGTGCAGACCCACCCAAGCTAGGTGAGGAGGTTAGGCAGA
AATCAGTTCTAGAGGATACAGATAGCCAGTGGTAGAGTTACCTCCTTTGGGTATCCTGGAGGACCTTTGTGGGGTGGAGA
TTGTCAGCCTTATTGTAGCCATGCTCTTGTCCTGGGTTAACTCCAGCCACTGGGCCTTTATCTGGGTGAGCCAAGACTCA
GTCTGGGCCACCGCCCTTGGGGGTCGGTGATATTGGGCAACCACT
Sequence Type genomic DNA
Unitrap ID UNI15061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181325344..181325626 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000823 (Znf512b) zinc finger protein 512B Gene [Source:MGI (curated);Acc:Znf512b-001]

 
Come back to gene ENSMUSG00000000823


For any suggestions or comments, please send an email to unitrap@crg.es