Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14304E8
Clone ID IST14304E8
Vector VICTR74
Project tigm

Sequence tag IST14304E8BBF1
Sequence
GTATAAGTAAGTTTAAATGTGAACCAAAGGTGACCTAGCCATGTAGCTCTCTGAACAATGGAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32916935..32917002 68
NO GENE  


Sequence tag IST14304E8HMF1
Sequence
GTATAAGTAAGTTTAAATGTGAACCAAAGGTGACCTAGCCATGTAGCTCTCTGAACAATGGAAGATCTTACTAAAATTTC
CTGTAAATATGCACACAAGGACAGAATCACAAACATTGCCTTTACAATGAGGCAAAGTTCCTGTGACATGAACTTGGCAC
AGATGCAATCTCTTCTTCAGCGCTCCATTACATCAACATAAAGTAACAAAACCAACAGCTAAAACAGCAAGCAACTACAC
AGAATAACTAAAGCGGCCTCAGGCAACCACTCTGTCTCTGAAACACCATTGTCATTGCTTCCTTCTGTAACAAAAGTATA
TTATTGCTTCAGACTCTACAAACCTCATAAAGTGTANTTAANGGGAAAATCACTACACAATGAAAAATCTTATGTTAAAA
CTGACACTGAATTGTTCTNATTTGAAGCATTATTGCNTTANNGAAAAAAAAATGANTGANAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32916539..32917002 448
NO GENE  


Sequence tag IST14304E8HMR1
Sequence
ATACTAAAGATACAAGTCCTCTAGCAAAAGCCCTAACTGN
Sequence Type genomic DNA
Unitrap ID UNI14684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32916999..32917037 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]

 
Come back to gene ENSMUSG00000014932


For any suggestions or comments, please send an email to unitrap@crg.es