Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13945A12
Clone ID IST13945A12
Vector VICTR74
Project tigm

Sequence tag IST13945A12BBF1
Sequence
GCATCAACTTAGGCAGGAAGTTCCCTATTGTCCAGCGACTTGGTAAAGGAGACAGGATTTGAGACAAAGCCCTCCCTTGT
AGGCTTTTCAAACCTTTGGGGGATATAGCATGAATATATACAGAAATAACTTTTAATGGCTGAGGAAGGAAGTAGACAAT
TGTTAAAAAGCTGTGCGTAAATACCAGGTGGTCACCCTGTCATTTAGCCAGCTATGGATGGGGTGAAAGGAGCCAGGCTG
AGCTTGCAATCCAAAGCGCTTGATCTTCACACTTCTGTTCTCCCCTGTGAAAGTGCACTGCTTAAACTATTCTCAGCTAC
TTCTATTTGTANGTGANTTTTTCAGACCGGCAGAAAACACAGGATGCTGGAAAATGCCACAGCATGTTACCTGACAAGGC
AGGTCTCAGCTGTTANCATCNAAAGGCTACATTTAAATACNANCCGCCTGTTGATGTTNAGTGGCGGCCNTTTGTTGTGG
TGGATNCTGTNNAANGGAAAANCTGCTCTCN
Sequence Type genomic DNA
Unitrap ID UNI34264

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25669696..25670204 480
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]


Sequence tag IST13945A12HMF1
Sequence
GCATCAACTTAGGCAGGAAGTTCCCTATTGTCCAGCGACTTGGTAAAGGAGACAGGATTTGAGACAAAGCCCTCCCTTGT
AGGCTTTTCAAACCTTTGGGGGATATAGCATGAATATATACAGAAATAACTTTTAATGGCTGAGGAAGGAAGTAGACAAT
TGTTAAAAAGCTGTGCGTAAATACCAGGTGGTCACCCTGTCATTTAGCCAGCTATGGATGGGGTGAAAGGAGCCAGGCTG
AGCTTGCAATCCAAAGCGCTTGATCTTCACACTTCTGTTCTCCCCTGTGAAAGTGCACTGCTTAAACTATTCTCAGCTAC
TTCTATTTGTAGGTGAGTTTTTCAGACCGGCAGAAAACACAGGATGCTGGAAAATGCCNCAGCATGTTACCTGACAAGGC
AGGTCTCAGCTGTTANCATCTAAAGGCTACATTTAAATACNAGCCGCCTGTTGATGTTAAGTC
Sequence Type genomic DNA
Unitrap ID UNI34264

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25669696..25670157 456
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es