Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10091C11
Clone ID IST10091C11
Vector VICTR75
Project tigm

Sequence tag IST10091C11HMF1
Sequence
GTTCTGAACTTGTAACACTGAACTATTATTTAGAACCTGCCCCCCACCCCCCATAAAAGGAGACACCAAGAGAATAGGAA
CTGTCCTTCACTAGGTGATGGAGTTGAACAATTCCTCTCTTATACAATCCAGGCCCACCAGGAACTTAAGATTCTCCTGC
TTGGACTCCCAAGTGCTAGAATTATATGATGGTCTACACAGCCTGCTCAGANACAGTTAANATTTTTTCCATTTTATCAT
TATTAGTGTGTGTATATATTCAATCAAATGTGCACTGAACATGACTGCATGTGAATTTACATACACAAACATACTTCTAN
GTTNTGCTTCAGAATAAGCAGGAGAGGAAAGTTGGGTGCTAGTCTGGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150725636..150726007 364
 
EST/CDNA Est Name
  DV068493.1 - BY321309.1 - BY327870.1 - BF101072.1 - BU057252.1 - CK390539.1 - BY247513.1 - AW209538.1 - CV676593.1 - BY249589.1 - CJ162726.1 - AI893287.1 - AW322752.1 - BY246662.1 - BY261822.1 - BY262689.1 - AI121050.1 - BY270422.1 - BY241916.1 - CX230145


Sequence tag IST10091C11BBR1
Sequence
AACAAAGGCATGTGAGAAGGTCAGTGTACTTTTTGCAGGTAGGTTTGGGTGGGGAAACGGCTTTCTAGGGAAGAGGGCAG
TCTGGGGAAAGCCATCTCTTTGAACTAAGTGGGTGAATGCTTTAGAAGCTAATCTTGTCCTTGTCCCTGGCTTCCAACAC
CAATGGGACTGGGGAGCAAGGTGTAACCAGAGTTAATTACCAGCCCCTGAAAGTTGGTAGTCAGTGATCTTGGGGACCTA
GGCTGGCTACAGGCAGGAGCCTCTGTCGCCACCTGCCCACTAGGGTGATTAACAAAGATACTTTTTGTTTTGTTTCGAGA
CAGGGTTTCTTTGTGTAACCCTGGCTGTCCTGGAACTGGCTAGATCAGGTAGACCAGGCTGGCCTCAAACTCAGAGATCC
Sequence Type genomic DNA
Unitrap ID UNI19854

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150725240..150725638 397
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]

 
Come back to gene ENSMUSG00000059119


For any suggestions or comments, please send an email to unitrap@crg.es