Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13082G3
Clone ID IST13082G3
Vector VICTR76
Project tigm

Sequence tag IST13082G3HMF1
Sequence
ATACAGCTCTCTGATGTTTAAATTGCCCATTTGTGTGTAACTGTGCCAATCCTCCCCCTACCCCCACTCCTTTCCTATAT
AAACCCCTAACTTTAGAGCCTCGAGACCGACATCCCTTATCTCCTGTGTGAGAGGACCTCTTGGAAGAGCAGTCAGTGCT
CTTAACCGCTGAACCCTCTCTCCAGCCCCCTGGAAGGTTCCTTAACCCTGAAGATTAACACTCCTGGCTGGATGGAAAGT
TCACTAGGAACTAACAGGAAACAGTAGAGTAAGAGGCTAGTGCTGGGTGTTTCTGGGTAGTCGTGAGTGTGGTAAAGTGG
AAGAAGGTCCCTGGCCTAAAGATTAAGAGGAGCACAGTGGGCTAGGAAGGTGATGGGGAGCTGAGTCAGTACTTGTCTTT
CCNTTGN
Sequence Type genomic DNA
Unitrap ID UNI13978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148154944..148155349 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025491 (Ifitm1) NM_026820 interferon induced transmembrane protein 1 Gene [Source:MGI (curated);Acc:Ifitm1-001]


Sequence tag IST13082G3BBF1
Sequence
ATACAGCTCTCTGATGTTTAAATTGCCCATTTGTGTGTAACTGTGCCAATCCTCCCCCTACCCCCACTCCTTTCCTATAT
AAACCCCTAACTTTAGAGCCTCGAGACCGACATCCCTTATCTCCTGTGTGAGAGGACCTCTTGGAAGAGCAGTCAGTGCT
CTTAACCGCTGAACCCTCTCTCCAGCCCCCTGGAAGGTTCCTTAACCCTGAAGATTAACACTCCTGGCTGGATGGAAAGT
TCACTAGGAACTAACAGGAAACAGTAGAGTAAGAGGCTAGTGCTGGGTGTTTCTGGGTAGTCGTGAGTGTGGTAAAGTGG
AAGAAGGTCCCTGGCCTAAAGATTAAGAGGAGCACAGTGGGCTAGGAAGGTGATGGGGAGCTGAGTCANTACTTGTCTTT
CCATTGGCCAGCTCCAGTGCCACTGACNNTCTGGTCTCTTCCAGTCTANGGACAGGAAGATGGTGGGTGATACGACTGGG
GCCCN
Sequence Type genomic DNA
Unitrap ID UNI13978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148154944..148155427 476
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025491 (Ifitm1) NM_026820 interferon induced transmembrane protein 1 Gene [Source:MGI (curated);Acc:Ifitm1-001]

 
Come back to gene ENSMUSG00000025491


For any suggestions or comments, please send an email to unitrap@crg.es