Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13431H12
Clone ID IST13431H12
Vector VICTR74
Project tigm

Sequence tag IST13431H12HMF1
Sequence
TTTTGGTTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGCACA
Sequence Type genomic DNA
Unitrap ID UNI9937 UNI29633 UNI30954 UNI32242

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74463176..74463227 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026175 (Vil1) NM_009509 villin 1 Gene [Source:MGI Symbol;Acc:MGI:98930]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 21321532..21321583 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30117953..30118004 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15676362..15676413 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59591790..59591841 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9139433..9139484 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 82962679..82962730 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23257264..23257315 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031478 (Nek3) NM_011848 NIMA (never in mitosis gene a)-related expressed kinase 3 Gene [Source:MGI (curated);Acc:Nek3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 77844..77895 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053211 (Zfy1) NM_009570 zinc finger protein 1, Y linked Gene [Source:MGI Symbol;Acc:MGI:99212]

 
Come back to gene ENSMUSG00000053211


For any suggestions or comments, please send an email to unitrap@crg.es