Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13139B11
Clone ID IST13139B11
Vector VICTR74
Project tigm

Sequence tag IST13139B11BBF1
Sequence
GGAAGCAGGGTAACATGAAATCAGGAGAGAGTGTTGACCCATTCCTTGTTCACGGCCCCTCACGGGAGAATGGAATTAAC
ATCAAATATAACTAGCCCCAGAGCTATCCACAATACTTTTGCCTTCAGTATGTGTTGATTTCAGTGATCTGAAGGCAAGA
AGGGCCTCCCAGGTTGCACTAGAAACAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI25726

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97635665..97635857 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018543 (1700001P01Rik) NM_028156 RIKEN cDNA 1700001P01 gene Gene [Source:MGI Symbol;Acc:MGI:1919465]


Sequence tag IST13139B11HMF1
Sequence
GGAAGCAGGGTAACATGAAATCAGGAGAGAGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI25726

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97635823..97635857 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018543 (1700001P01Rik) NM_028156 RIKEN cDNA 1700001P01 gene Gene [Source:MGI Symbol;Acc:MGI:1919465]

 
Come back to gene ENSMUSG00000018543


For any suggestions or comments, please send an email to unitrap@crg.es