Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12912H8
Clone ID IST12912H8
Vector VICTR76
Project tigm

Sequence tag IST12912H8BBF1
Sequence
CTGAACAGCAAGCTTCATATATTCTATCCACGTAGCACATGTATCTTTCAAGCAGTGCGGGAAACAATTTANNNNNNCAT
TTTTCAGAGCATCAAATCTCTTCTTTGCTTACAGGTGGAGCAGATAGACAATAAGGTGCTGCTGGCTGCCTTCCAAGAGA
AGAAGAAAATGATGGAAGAGAGGACGCCAAAGGGATCTGGGAGCCAAAGGTTGTTTCAGCAGGTCCCACATCAGTTCTGC
AATACGGTGTGCAGAGTCGGCTTCCACAGAATGTATTCGACATCCTATAGTAGGTGTCAGGCTTGTCCTCTGGGCGTGTC
TTCAGGGCTGCCTACTTGGGCACAGGCTAGCAGANTCAGTGGGTGACTGTCGGGGANGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35969563..35969944 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]


Sequence tag IST12912H8HMF1
Sequence
NTGANCANNANNCTTCATATATTCNATNNNCNTAGCACATGTATCTTTCAAGCNNTGCGGGAAACAATTTAAGTAGCCAT
TTTTCAGAGCATCAAATCTCTTNTTTGCTTACNGGTGGANCANATANACAATAAGGTGCTGCTGGCTGCCTTCCAAGAGA
ANAANAAAATGATGGANNANAGGACGCCNAAGGGATCTGGGAGCCNAAGGTTGTTTCANCAGGTCCCACATCANTTCTGC
AATACGGTGTGCANAGTCNGCTTCCNCAGAATGTATTCGACATCCTATAGTANGTGTCAGGCTTGTCCTCTGGGCGTGTC
TTCNNGGCTGCCTACTTGGGCACAGGCTNNCAGANTCNGTGGGTGACTGTCNGGGANGGATCCTTCTCCCCTGGGCTTNN
NGANTGAANTCTTTTANAAATGGTCACTCTTTTATCTTTTNTGTCTTTTGTTTGNGTGCGANACATTGATGGGAGAANGG
ACNGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022906


For any suggestions or comments, please send an email to unitrap@crg.es