Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12155H5
Clone ID IST12155H5
Vector VICTR76
Project tigm

Sequence tag IST12155H5HMR1
Sequence
GTAACTTTCTCTGGGTTGCATCTTTAAAAATGTTGCAAAGCAAAATTTTGTTTCNTGCCTGCCTGATGTTCCCAACCACC
AAGGTATAACGTTACCTTCTGGAGTGTTTTCCTCCTTCAAATAGGTACCCCTGCTGAGTCTCCACANATTTATGGGAGAA
AGAGATATATTAGAAGTGGCAGCANAAGTCTTCCANCCGAGTGGTTTTTACATTACGAGTTTCTTANGGATGCTGTANAG
AGTCGGGT
Sequence Type genomic DNA
Unitrap ID UNI30921

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32243359..32243606 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027663 (Zmat3) NM_009517 zinc finger matrin type 3 Gene [Source:MGI (curated);Acc:Zmat3-001]

 
Come back to gene ENSMUSG00000027663


For any suggestions or comments, please send an email to unitrap@crg.es