Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST13727-NL
Clone ID PST13727-NL
Vector U3NeoSV1
Project escells

Sequence tag PST13727-NL
Sequence
TTAATTTAGGACTTAAAATTTAAAGTTATTTTTTTCTGATGTCTAAAAGGCTTCCTTAAAGGCAGTGTTATCTTGGTCCT
TTACTACACCATTGATAACATTTGACTTTTAACTTTGTACCAGAGAAGTAAAAGGTTTCTGTCATTTGTGATGATATTTT
TAAATTTTTTTGCAGGTGGAAGAAGAAAGGTGCCACTTTGGCATGAAGATAGACTCACTTAGACGTCAATCTTTTAAGCT
GAGTGCATTGTGATTTCCAATAATTGAGGCAGTGGTTCTAAAAGCTGTCTAC
Sequence Type genomic DNA
Unitrap ID UNI15072

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18284673..18284964 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022718 (Dgcr8) NM_033324 DiGeorge syndrome critical region gene 8 Gene [Source:MGI (curated);Acc:Dgcr8-002]

 
Come back to gene ENSMUSG00000022718


For any suggestions or comments, please send an email to unitrap@crg.es