Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST13717-NL
Clone ID PST13717-NL
Vector U3NeoSV1
Project escells

Sequence tag PST13717-NL
Sequence
TTGGTGATCGGAAGATGGGAGAAGGATCAGGGTGGGCCAGCGGAAGGTTGGCGGGGGTGGGAGGGGGGGAAGGACCAAAA
AGATCAGGCAAGGTGTTCGTTGGGGTTTGTGTGGTTCCTTTTTTCTTCTCGTACCAGCACCCTGTCTCTGTCCAGGCCCA
GGGGACACCCCCACTCCATCCCCTGGGATCCACAGCTTAGGAATGGACCTTCTCACCCCACATCACACTCCTACTGTTGT
CATGGCTGTGTTCACCAAGCTGTGAGCACCAGGTGGTAGGCCTGTCTGGT
Sequence Type genomic DNA
Unitrap ID UNI14704

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133576488..133576660 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030727 (Rabep2) NP_085043 rabaptin, RAB GTPase binding effector protein 2 Gene [Source:MGI (curated);Acc:Rabep2-001]

 
Come back to gene ENSMUSG00000030727


For any suggestions or comments, please send an email to unitrap@crg.es