Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST13696-NR
Clone ID PST13696-NR
Vector U3NeoSV1
Project escells

Sequence tag PST13696-NR
Sequence
ATCTTGACTGGGAGGGTCTCACTCTGAGTAGATTGACTACCCGTCAGCGGGAGGTCTTTCAGTAAGAACCCAAGGGCTCC
CCAGTGCCTTGACCATCCTGATTCGTCTGACAATAGAATTGAAGACAGAAATGAAGCAAGAAGCCCCACCCAGCTTCCTC
CCCCCTGAAGCCTCACAGCTCAAGACAGACAGACCACAATTCCAGAATCGAAAGAGGCCCTTATGAAGAGAATCGAGGCC
GTGGGTACTTCGAGCACCGAGAGGATCGAAGGTGGGTACATGC
Sequence Type genomic DNA
Unitrap ID UNI15076

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26533331..27249548 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040725 (Hnrnpul1) NM_178089 heterogeneous nuclear ribonucleoprotein U-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443517]

 
Come back to gene ENSMUSG00000040725


For any suggestions or comments, please send an email to unitrap@crg.es