Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14629B5
Clone ID IST14629B5
Vector VICTR74
Project tigm

Sequence tag IST14629B5HMF1
Sequence
GAAGAATAACTAGTACCTCACACATCATCATCACAGCATGTCAGCAGCCATTCCCTTCCCCTCCTGGATTGCCCTCCACC
TTTTACATCATCCATCCAGCTGTTAAAGCTAACTTTGAGGCTTCACACTTGATTTTTCCTTTCCTTTCCCTTCCTTTCCC
TTCCTTTCCTCCACATCACTGTATCGGGAAGTTCTAGCAGACCTACTTGTGAAGTACATGTGGTTCCATCTCCACCATCA
TCCAATCGCAGTCTCAGCCTACAGTACGTTCAACGGAGTGTCCCTTCATTTAAATCTTACCACCTTCAGTCTCCACAAAC
CACCCTTACTTGAAGTCAAATCAGTCCTGGCCTGCTTTAAATAACCTCTGTTNNAAGTGTGTGTTAATAAGATCTNAATT
CCCANCCTGGNNCTNAAGCTGGCCCCNGTCTACTGATTCCATGTCTTTCCTCTCTCTTCCCTATTCNNACTCTTNTTTGA
ACAAACCACATTGATNNCGTANGTCCTCNNCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 105574383..105574890 480
 
EST/CDNA Est Name
  BY405281.1 - CA328078.1 - BY007980.1 - BY724847.1 - BG101144.1 - BB866480.1 - BB656896.1 - BQ938155.1 - BG919626.1


Sequence tag IST14629B5HMR1
Sequence
CTTCTTAAGGAAAGTTGGATGCTCTAGAAAGTGGGCCAGGACTAGAGAGATACAATGTCATGCTACTAGGATTTGAAGCT
AGAAAATTGTGGGAGGGTTCTTGGGAACAATGTGTAGATATGGAATAGACAGGATTGAGGTAGGGGGTATGGCAAAAGCA
GGGGCTGTTAAACTGGTGGGATTCTACAGACTGATGCATGCANTANGTTCAAAGCTCTTAGATTTGACAANNTGNCN
Sequence Type genomic DNA
Unitrap ID UNI22553

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 105574157..105574386 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022119 (Rbm26) NM_134077 RNA binding motif protein 26 Gene [Source:MGI Symbol;Acc:MGI:1921463]


Sequence tag IST14629B5BBF1
Sequence
GAAGAATAACTAGTACCTCACACATCATCATCACAGCATGTCAGCAGCCATTCCCTTCCCCTCCTGGATTGCCCTCCACC
TTTTACATCATCCATCCAGCTGTTAAAGCTAACTTTGAGGCTTCACACTTGATTTTTCCTTTCCTTTCCCTTCCTTTCCC
TTCCTTTCCTCCACATCACTGTATCGGGAAGTTCTAGCAGACCTACTTGTGAAGTACATGTGGTTCCATCTCCACCATCA
TCCAATCGCAGTCTCAGCCTACAGTACGTTCAACGGAGTGTCCCTTCATTTAAATCTTACCACCTTCAGTCTCCACAAAC
CACCCTTACTTGAAGTCAAATCAGTCCTGGCCTGCTTTAAATAACCTCTGTTCCAAGTGTGTGTTAATAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 105574383..105574777 395
 
EST/CDNA Est Name
  BY405281.1 - BY007980.1 - BG101144.1 - BQ938155.1 - BG919626.1

 
Come back to gene BY405281.1 - BY007980.1 - BG101144.1 - BQ938155.1 - BG919626.1


For any suggestions or comments, please send an email to unitrap@crg.es