Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14291A8
Clone ID IST14291A8
Vector VICTR74
Project tigm

Sequence tag IST14291A8BBF1
Sequence
TATTTTTTAAACCNAGAAACACCTCTTTGACAGTCTTAGGATCAAATCAGTTTGAAATTCTGCTTAGTTGCAGATTTATC
TGCTCATACCATAACTCACTATCTGAGTTTCATGACAAACCAGAACCGTGTGTAAGGANCGCTGTGTCTGGACATGCTTT
GTGCGGTCATCCTGTGGTGTTTGGGGCAATCCNCATTGTCTCCTCACAGTGGCTCAGAATTTCCNGANACTGTANTTACC
ATAGATACNGCGATTGTAAATCATTTCANGAAATTAAATCCNGCGACCNAAACAAGGAGTTATTCTAAACCTGCTCTTTT
GACCGAAACNTGAGTTGTTGGACCCCGAGNTGTGTGACNGN
Sequence Type genomic DNA
Unitrap ID UNI13150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27937200..27937557 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056692 (D17Wsu92e) NM_001044719 Uncharacterized protein C6orf106 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3TT38]


Sequence tag IST14291A8HMR1
Sequence
AATACAANNGNNNGANNTNTTTAAAGTTGCCAAAAAGTATCTGAATACACAATTTATCCTATAATTTAGCTGTTATTGCT
GTAAAAATTAGGAAATATAATAAAGGCAGAATTTATGGGCTTTGCTAAGAAATATCATATACCTTTTACAATCTCTTTGA
TTAAATGTTTCTGTTGTGTCTAANAATTCCTGCCTGTGAGATCTTGGGACACTGTGCTTCCCATAGGGACCANCCTCAAA
GTGGCTTANTTTCATTTCCCCTGAGGAACGTGCCGGCTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27937554..27937835 260
 
EST/CDNA Est Name
  AW824413.1 - BG230287.1 - BE979906.1 - BE688798.1 - CJ171194.1 - AI835178.1 - AI666342.1 - AW123169.1 - BE957410.1 - BE952887.1


Sequence tag IST14291A8HMF1
Sequence
TATTTTTTAAACCAAGAAACACCTCTTTGACAGTCTTAGGATCAAATCAGTTTGAAATTCTGCTTAGTTGCAGATTTATC
TGCTCATACCATAACTCACTATCTGAGTTTCATGACAAACCAGAACCGTGTGTAAGGAGCGCTGTGTCTGGACATGCTTT
GTGCGGTCATCCTGTGGTGTTTGGGGCAATCCACATTGTCTCCTCACAGTGGCTCAGAATTTCCAGAAACTGTANTTACC
ATAGATACAGCGATTGTAAATCATTTCAGGAAATTAAATCCNGCGACCAAAACAAGGAGTTATTCTAAACCTGCTCTTTT
GACCGANACGTGAGTTGTTGGACCCNGAGTGTGTNACNNANNTGACTCN
Sequence Type genomic DNA
Unitrap ID UNI13150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27937189..27937557 347
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056692 (D17Wsu92e) NM_001044719 Uncharacterized protein C6orf106 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3TT38]

 
Come back to gene ENSMUSG00000056692


For any suggestions or comments, please send an email to unitrap@crg.es