Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14162D2
Clone ID IST14162D2
Vector VICTR74
Project tigm

Sequence tag IST14162D2HMR1
Sequence
NTTTATATTGTTTGTGACNATTGTGAAGGGTGTCATTTCCCTAATTTCTTTCTTAGCCTGTTCATCCTTTGAGTATAGGA
AGGCTACTGATCTGTTTGAGTTAATTTTATATC
Sequence Type genomic DNA
Unitrap ID UNI24534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13273353..13273464 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079844 (Mkl2) NM_181860 MKL/myocardin-like 2 Gene [Source:MGI (curated);Acc:Mkl2-004]


Sequence tag IST14162D2HMF1
Sequence
AAGTATCTTGGTGTGACTCGAACCAGAGAAAGATCTGTATGACCAAAACTTCNNNNNNCTGAAGAAAGAAATCAGAGAAG
ACCTCAGAAGATGGAAAGCTCTCCCATGCTCGTGGATTGGCAGGATTAATATAGTAAAAATGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14162D2BBF1
Sequence
AAGTATCTTGGTGTGACTCGAACCAGANAAAGATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13273317..13273354 36
NO GENE  

 
Come back to gene ENSMUSG00000079844


For any suggestions or comments, please send an email to unitrap@crg.es