Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14138B7
Clone ID IST14138B7
Vector VICTR74
Project tigm

Sequence tag IST14138B7BBF1
Sequence
GTTCCTTCCAGGGTGAGTATGGAAGGTTGAGGCAATACTCCCAGGAAGGCCATGAACTAGGCTTCCTTAGGAAAATGAGC
TTGGTGGCGCATACATTAATCCCAGAGCTCANAAGGCAGGCAGGTGGTTTCTATGAATTTGAGACCAGCCTGGCTTACAA
AGCAAGCTCCAGCCCGGCCAAGGCTACAGAGTGAGACCCTGTGTTCCAAAAGATAAAATAAAATAAATCCCTAAACCTCA
TACNCNTAAAATAAATTGATGAAAATCAAAAGAGAAAGCAGCTGTGTGAATCCTGTTGGTCTTAGCAGGCACTTTGGTCT
GAGCCNGGTTCTGTCTGTTTGTTTGTTTTGTTTTGAAACAGGTCTTGCTGTGATGCCCTCNNCGGTCTTGAACTCTCTTT
GTGGCCTANGCTGGCCTGGAACTTGTCATCCNCCCTCCAGCCCTANNNTCCNNAGCACTATTGNTCCTGGNATNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58096299..58096771 443
 
EST/CDNA Est Name
  CN675108.1 - BY212900.1 - BY221010.1 - BB844245.1 - CN671058.1 - CF907242.1 - CN677934.1 - CN676012.1 - CN677667.1 - BF537194.1 - BI655771.1 - CN680881.1 - CN677966.1 - BY218454.1 - CD539987.1 - BU519155.1 - CD541369.1 - BB659153.1 - BY722732.1 - BB665920


Sequence tag IST14138B7HMR1
Sequence
NAACTACCTCCATCCCATTATTCTTCACTCATTTTTCCCTTCACAAAAAACACAAATAAGGTCACATTGCCCTAACTTTT
TATTATTAGCATTATATAGCTAAGGATTAAAAATACTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI10340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58096182..58096301 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]


Sequence tag IST14138B7HMF1
Sequence
TTCCTTCCNGGGTGAGTATGGAAGGTTGAGGCAATACTCCCAGGAAGGCNATGAACTAGGCTTCCTTANGAAAATGAGCT
TGGTGGCGCATACATTAATCCCAGAGCTCANAAGGCAGGCAGGTGGTTTCTATGAATTTGAGACCAGCCTGGCTTACAAA
GCAAGCTCCAGCCCGGCCAAGGCTACNNAGTGAGACCCTGTGTTCCAAAAGATAAAATAAAATAAATCCCTAAACCTCNT
NCANNNNNNNNNNNTTGATGAAAATCAAAAGANAAAGCNGCTGTGTGAATCCTGTTGGTCTTAGCAGGCACTTTGGTCTG
AGCCAGGTTCTGTCTGTTTGTTTGTTTTGTTTTGAAACNGGTCTTGCTGTGATGCCCTCAGCGGTCTTGAACTCTCTTTG
TGGCCTNNCTGGCCTGNAACTTGTCATCCTCCCCTCCAGCCCTACCATCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036986


For any suggestions or comments, please send an email to unitrap@crg.es