Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR1000
Clone ID XR1000
Vector pGT0lxf
Project sanger

Sequence tag XR1000
Sequence
CCTGGCTCTCTGTTCCTCTCCGTTGCGAGCAAGCTGAAAGATTGGTCTGATGTGTTTTGATCTCTGCTGCCAGGACCCTA
GGGCAATGCCAGCGATCTACAACGTGGCGACATGGTCCA
Sequence Type mRNA
Unitrap ID UNI2143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62659845..62659957 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074865 (6720457D02Rik) RIKEN cDNA 6720457D02 gene Gene [Source:MGI Symbol;Acc:MGI:1924367]

 
Come back to gene ENSMUSG00000074865


For any suggestions or comments, please send an email to unitrap@crg.es