Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10774G3
Clone ID IST10774G3
Vector VICTR76
Project tigm

Sequence tag IST10774G3BBF1
Sequence
CTACCTGGCCTTCCAGGACATCGGCGCCTGCGTGGCGCTGCTCTCCGTTCGCGTCTACTACAAGAAGTGTCCCGAGATGC
TGCAGAGCTTGGCTCGCTTCCCCGAGACCATTGCTGTCGCTGTCTCCGATACACAACCCCTGGCCACGGTGGCCGGTACC
TGCGTGGACCATGCCGTGGTGCCTTATGGGGGCGAGGGGCCTCTCATGCACTGCACGGTGGATGGCGAGTGGCTGGTGCC
CATCGGGCAGTGCCTGTGCCAGGAAGGCTACGANAAGGTCGAGGATGCCTGCCGAGGTGAGAGGGGGTTCCTGGGGTGTC
AGGGAAGCCCGACTGGGGTGGGGGGCTACGGGCACGTGATTGGAACACCTTAGTACATTGGGGATGTGGTTGCTCCGTGG
ATGCCTCTGCTCTCGGGTGGTGGTCCCGTGACCGGAAGCTTCCTGGGAACAGGACGGTGTANAGACTATGAGCCAGGGTT
ACGGTTCTAGGACGACNNAGCTTN

Sequence Type genomic DNA
Unitrap ID UNI4399

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140864700..140865202 495
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]


Sequence tag IST10774G3HMF1
Sequence
CTACCTGGCCTTCCAGGACATCGGCGCCTGCGTGGCGCTGCTCTCCGTTCGCGTCTACTACAAGAAGTGTCCCGAGATGC
TGCAGAGCTTGGCTCGCTTCCCCGAGACCATTGCTGTCGCTGTCTCCGATACACAACCCCTGGA

Sequence Type genomic DNA
Unitrap ID UNI9498

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140864700..140864842 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]

 
Come back to gene ENSMUSG00000006445


For any suggestions or comments, please send an email to unitrap@crg.es