Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11788C10
Clone ID IST11788C10
Vector VICTR76
Project tigm

Sequence tag IST11788C10HMR1
Sequence
TGTATTGACTCNGTAAGGTCAGGTGACTTTAATTTTCAACCTCCATTTGATGTCCTCTTTATTACTTGATCTATGTATGG
CCCAAAGATGATTGTGTGCAGATCCCAGGAGAAAGAGGAGTTTCCTGG
Sequence Type genomic DNA
Unitrap ID UNI9953

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5285449..5285575 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069729 (Arid1b) AT rich interactive domain 1B (SWI-like) Gene [Source:MGI (curated);Acc:Arid1b-001]

 
Come back to gene ENSMUSG00000069729


For any suggestions or comments, please send an email to unitrap@crg.es