Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14411A1
Clone ID IST14411A1
Vector VICTR74
Project tigm

Sequence tag IST14411A1HMF1
Sequence
TANNGATATATACTAATAAGACAACATAAACCTATTTTGCATTTTACAAACCCAAACAATTCTAATTTCTATATTAATAA
GTTAAAAAACTTGTAAAAGCAGTAATATAAAATATCTCTTTTCTTCTGTTAGGTCCCTACCACTACAGAGAGATCTAATT
CATTAAAGTCTTAGTTTTATTAGTGGCAAGCCTGACATCTCTACTTCACCCTCTACCAAAAATACAGCAATTTCTGAGGT
AAAAGGTCTTTTGTTTTTGCTTTGGGCTTGGGTTGGTTGGCTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92043085..92043366 282
NO GENE  


Sequence tag IST14411A1HMR1
Sequence
GATAATTGCCAAATACCAGCTGGTAGTTTTTTGTTTTTGAAACAGAGTTTATCTGTGTATCCATGGCTGTCCTGGAATAC
TCTCTGGAGACCAGGTTGGCCTCAAATTCACTGANATCTGCCTGCCTCTACCTCTCAAGTGCTGAGATTGAAGGCATGTG
CCAACACAACCCGTATTGAATTGTTC
Sequence Type genomic DNA
Unitrap ID UNI14434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92043389..92043573 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]


Sequence tag IST14411A1BBF1
Sequence
NNNNGATATATACTAATAAGACAACATAAACCTATTTTGCATTTTACAAACCCAAACAATTCTAATTTCTATATTAATAA
GTTAAAAAACTTGTAAAAGCAGTAATATAAAATATCTCTTTTCTTCTGTTAGGTCCCTACCACTACAGAGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92043215..92043366 152
NO GENE  

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es