Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST13549-NL
Clone ID PST13549-NL
Vector U3NeoSV1
Project escells

Sequence tag PST13549-NL
Sequence
TAGGTGCAAGATCCATTTGGAGTTGTTTTTGTGGAGGTTGTAGAAGACATTTTATGTGCTGGGTAG
Sequence Type genomic DNA
Unitrap ID UNI14678

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 174892822..174892887 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078905 (OTTMUSG00000016546) NP_001079015 predicted gene, OTTMUSG00000016546 Gene [Source:MGI Symbol;Acc:MGI:3649576]

 
Come back to gene ENSMUSG00000078905


For any suggestions or comments, please send an email to unitrap@crg.es