Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12752D5
Clone ID IST12752D5
Vector VICTR76
Project tigm

Sequence tag IST12752D5BBF1
Sequence
GTGAGGCACTGGCANAGCCTCTCAGGAGAGAGCTATATCAGGCTCCTGTCAGCAAGCACTTGTTGGCATCCACAATAGTG
TCTGTTTTTGGTGGTTGTTTATGGGATGAATCCCCANGTGGGGCATTCTCTGGATGATNNNTCNTTNANTCTCTACTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12752D5HMF1
Sequence
NTGAGGCACTGGCAGAGCCTCTCAGGANAGAGCTATAAN
Sequence Type genomic DNA
Unitrap ID UNI32326 UNI34873

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 99385632..99385667 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 26167219..26167254 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 119969232..119969267 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 75414844..75414879 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 32740214..32740249 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94013015..94013050 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21446861..21446896 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 41482010..41482045 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 26064469..26064504 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20099011..20099046 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040003 (Magi2) NM_015823 membrane associated guanylate kinase, WW and PDZ domain containing 2 Gene [Source:MGI (curated);Acc:Magi2-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 7523180..7523215 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 112053980..112054015 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 69053078..69053113 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 97031345..97031380 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071719 (Tmem28) NM_001081283 transmembrane protein 28 Gene [Source:MGI (curated);Acc:Tmem28-001]

 
Come back to gene ENSMUSG00000071719


For any suggestions or comments, please send an email to unitrap@crg.es