Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14013H6
Clone ID IST14013H6
Vector VICTR74
Project tigm

Sequence tag IST14013H6HMF1
Sequence
GTGGCAGGAAGGTTGTTTGGCCTCAGGGTGGAGTAATGAANAACCCGCTCTGGGGTTTTAGGATAGAGGAGCAGAGTGTG
AGGTTTGCCCTGATCTCTAACCATCATGGTTTTGTGCCTGTAGTGGACCCACATGGAGGCTCACCCCTGGCTAGTCCCAT
GTCCCCTCGATCTCTCTCCTCCAATCCATCCTCACGGGACTCTTCGCCTAGCCGAGACTACTCACCAGCTGTCAGTN
Sequence Type genomic DNA
Unitrap ID UNI31822

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87440172..87440407 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]


Sequence tag IST14013H6BBF1
Sequence
GTGGCAGGAAGGTTGTTTGGCCTCAGGGTGGAGTAATGAAAAACCCGCTCTGGGGTTTTAGGATANAGGAGCAGAGTGTG
AGGTTTGCCCTGATCTCTAACCATCATGGTTTTGTGCCTGTAGTGGACCCACATGGAGGCTCACCCCTGGCTAGTCCCAT
GTCCCCTCGATCTCTCTCCTCCAATCCATCCTCACGGGACTCTTCGCCTANCCGAGACTACTCACCAGCTGTCAGTGGAN
NNTNTTNNNNNNTCACNNTNNNANGCTCANGCAANANNTATGGGTTCNCNCTGCGAGCCNTCCGTGTCTACATGGGCNAN
TCCNATGTCTACANTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053693


For any suggestions or comments, please send an email to unitrap@crg.es